Transcript: Mouse NM_023266.4

Mus musculus zinc finger protein 120 (Zfp120), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zfp120 (104348)
Length:
4032
CDS:
37..429

Additional Resources:

NCBI RefSeq record:
NM_023266.4
NBCI Gene record:
Zfp120 (104348)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095558 TGTTACAATAGTCTCCAGATA pLKO.1 1143 3UTR 100% 4.950 3.960 N Zfp120 n/a
2 TRCN0000095555 CGAAACAGTCATCTCTTAATA pLKO.1 723 3UTR 100% 15.000 10.500 N Zfp120 n/a
3 TRCN0000095556 GACGCTACAGTTCTCTTCAAA pLKO.1 973 3UTR 100% 5.625 3.938 N Zfp120 n/a
4 TRCN0000095554 GCTACAGAACATACTTGGAAA pLKO.1 1804 3UTR 100% 4.950 3.465 N Zfp120 n/a
5 TRCN0000095557 CAAAGTGGTCTCCTCTATCAT pLKO.1 810 3UTR 100% 5.625 3.375 N Zfp120 n/a
6 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 927 3UTR 100% 15.000 7.500 Y ZNF443 n/a
7 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 927 3UTR 100% 15.000 7.500 Y Zfp97 n/a
8 TRCN0000216285 CAATAGTCTCCAAGTACATAA pLKO.1 896 3UTR 100% 13.200 6.600 Y AI987944 n/a
9 TRCN0000242409 GAATGTAACCAATGTGGTAAA pLKO_005 693 3UTR 100% 10.800 5.400 Y Gm14418 n/a
10 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 506 3UTR 100% 15.000 7.500 Y Zfp984 n/a
11 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 761 3UTR 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023266.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.