Transcript: Mouse NM_023294.2

Mus musculus NDC80 kinetochore complex component (Ndc80), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ndc80 (67052)
Length:
2201
CDS:
157..2085

Additional Resources:

NCBI RefSeq record:
NM_023294.2
NBCI Gene record:
Ndc80 (67052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414191 GAATTGCAGCAGACTATTAAT pLKO_005 1279 CDS 100% 15.000 21.000 N NDC80 n/a
2 TRCN0000088288 GCTGACATTGAGAGAATAAAT pLKO.1 1246 CDS 100% 15.000 21.000 N Ndc80 n/a
3 TRCN0000308803 GCTGACATTGAGAGAATAAAT pLKO_005 1246 CDS 100% 15.000 21.000 N Ndc80 n/a
4 TRCN0000305156 ACTACAGAGTATCGTTGATAA pLKO_005 1209 CDS 100% 13.200 18.480 N Ndc80 n/a
5 TRCN0000088292 CGTATGAACTTCCTGGTACAA pLKO.1 572 CDS 100% 4.950 6.930 N Ndc80 n/a
6 TRCN0000088289 GCGTCCTTACAAGCAGATGTT pLKO.1 1057 CDS 100% 4.950 6.930 N Ndc80 n/a
7 TRCN0000088290 CGCTGACATTGAGAGAATAAA pLKO.1 1245 CDS 100% 15.000 12.000 N Ndc80 n/a
8 TRCN0000305157 CGGTTATGTGTATAGTGTATC pLKO_005 474 CDS 100% 10.800 8.640 N Ndc80 n/a
9 TRCN0000088291 CGTCGTATGAACTTCCTGGTA pLKO.1 569 CDS 100% 2.640 2.112 N Ndc80 n/a
10 TRCN0000305154 TGAATTGCAGCAGACTATTAA pLKO_005 1278 CDS 100% 15.000 10.500 N Ndc80 n/a
11 TRCN0000088004 GCATTCATTCAGCAGTGTATT pLKO.1 424 CDS 100% 13.200 9.240 N LOC433869 n/a
12 TRCN0000305155 AGTGTATTCGACAACTCTATG pLKO_005 437 CDS 100% 10.800 7.560 N Ndc80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.