Transcript: Mouse NM_023544.5

Mus musculus regulatory solute carrier protein, family 1, member 1 (Rsc1a1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rsc1a1 (69994)
Length:
2154
CDS:
118..1866

Additional Resources:

NCBI RefSeq record:
NM_023544.5
NBCI Gene record:
Rsc1a1 (69994)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023544.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112868 CATGTCTACAATGGATAACAA pLKO.1 1029 CDS 100% 5.625 2.813 Y Rsc1a1 n/a
2 TRCN0000112866 CCCAATAGCATTGAATCTCTA pLKO.1 247 CDS 100% 4.950 2.475 Y Rsc1a1 n/a
3 TRCN0000112865 CGCTTCAGATAATCCCACTAT pLKO.1 915 CDS 100% 4.950 2.475 Y Rsc1a1 n/a
4 TRCN0000112867 GCCCTGATGGAAGTAGATACA pLKO.1 814 CDS 100% 4.950 2.475 Y Rsc1a1 n/a
5 TRCN0000112869 CTAGTTTAACTCTCACAACTA pLKO.1 491 CDS 100% 0.000 0.000 Y Rsc1a1 n/a
6 TRCN0000420524 TCACTGGGAATGTCATCATTA pLKO_005 109 5UTR 100% 13.200 6.600 Y DDI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023544.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.