Transcript: Mouse NM_023644.4

Mus musculus methylcrotonoyl-Coenzyme A carboxylase 1 (alpha) (Mccc1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mccc1 (72039)
Length:
2992
CDS:
122..2275

Additional Resources:

NCBI RefSeq record:
NM_023644.4
NBCI Gene record:
Mccc1 (72039)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023644.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348143 AGTCATAGCTGTGACGTATAA pLKO_005 1795 CDS 100% 13.200 18.480 N Mccc1 n/a
2 TRCN0000112507 CCTGGTATTAATCCTGAAGTA pLKO.1 983 CDS 100% 4.950 6.930 N Mccc1 n/a
3 TRCN0000112508 GAGGCGAAGAAGTCTTTCAAT pLKO.1 809 CDS 100% 5.625 3.938 N Mccc1 n/a
4 TRCN0000334254 GAGGCGAAGAAGTCTTTCAAT pLKO_005 809 CDS 100% 5.625 3.938 N Mccc1 n/a
5 TRCN0000112505 GCAGTGAACTGTGTCCAGAAA pLKO.1 2281 3UTR 100% 4.950 3.465 N Mccc1 n/a
6 TRCN0000334255 GCAGTGAACTGTGTCCAGAAA pLKO_005 2281 3UTR 100% 4.950 3.465 N Mccc1 n/a
7 TRCN0000112506 GCATACCATAAAGGCTCCAAA pLKO.1 2158 CDS 100% 4.950 3.465 N Mccc1 n/a
8 TRCN0000112509 GCAGATTGACAACAAGTCCTT pLKO.1 1837 CDS 100% 2.640 1.848 N Mccc1 n/a
9 TRCN0000334188 GCAGATTGACAACAAGTCCTT pLKO_005 1837 CDS 100% 2.640 1.848 N Mccc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023644.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.