Transcript: Mouse NM_023805.3

Mus musculus solute carrier family 38, member 3 (Slc38a3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc38a3 (76257)
Length:
2622
CDS:
314..1831

Additional Resources:

NCBI RefSeq record:
NM_023805.3
NBCI Gene record:
Slc38a3 (76257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_023805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055365 CCCGTTTGATGTGCTGATCTT pLKO.1 1396 CDS 100% 4.950 6.930 N Slc38a3 n/a
2 TRCN0000419198 GCCATCTTCTACTTCCGAATC pLKO_005 1661 CDS 100% 6.000 4.200 N SLC38A3 n/a
3 TRCN0000055366 CCTCAACTCACAGACAGCATA pLKO.1 1159 CDS 100% 4.950 3.465 N Slc38a3 n/a
4 TRCN0000055364 CGCAGTCATCTATAAGAAGTT pLKO.1 997 CDS 100% 4.950 3.465 N Slc38a3 n/a
5 TRCN0000055363 CGTGCATCAATCTGCTGGTTA pLKO.1 1563 CDS 100% 4.950 3.465 N Slc38a3 n/a
6 TRCN0000055367 CCTGTTGTCTAGCTATTCCAT pLKO.1 631 CDS 100% 3.000 2.100 N Slc38a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_023805.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.