Transcript: Human NM_024016.4

Homo sapiens homeobox B8 (HOXB8), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
HOXB8 (3218)
Length:
2176
CDS:
589..1320

Additional Resources:

NCBI RefSeq record:
NM_024016.4
NBCI Gene record:
HOXB8 (3218)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024016.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304443 TGCCTATTCACGCCGTAATTC pLKO_005 1747 3UTR 100% 13.200 18.480 N Hoxb8 n/a
2 TRCN0000285119 TAAGCGGCGAATCGAGGTATC pLKO_005 1107 CDS 100% 6.000 8.400 N HOXB8 n/a
3 TRCN0000016018 CGCTAGTGGTAGTATCTCGTA pLKO.1 1475 3UTR 100% 2.640 3.696 N HOXB8 n/a
4 TRCN0000285121 CGCTAGTGGTAGTATCTCGTA pLKO_005 1475 3UTR 100% 2.640 3.696 N HOXB8 n/a
5 TRCN0000016021 CCCGTCGCAAATCCAGGAGTT pLKO.1 738 CDS 100% 1.350 1.890 N HOXB8 n/a
6 TRCN0000016020 CCAATTATTATGACTGCGGCT pLKO.1 650 CDS 100% 0.540 0.756 N HOXB8 n/a
7 TRCN0000016022 CGCGCAGAAGGGCGACAAGAA pLKO.1 1296 CDS 100% 0.000 0.000 N HOXB8 n/a
8 TRCN0000285124 CGCGCAGAAGGGCGACAAGAA pLKO_005 1296 CDS 100% 0.000 0.000 N HOXB8 n/a
9 TRCN0000273964 AGTACGCAGACTGCAAGCTTG pLKO_005 905 CDS 100% 4.050 3.240 N HOXB8 n/a
10 TRCN0000070880 GTTCCTATTTAATCCCTATCT pLKO.1 1080 CDS 100% 4.950 3.465 N Hoxb8 n/a
11 TRCN0000349142 GTTCCTATTTAATCCCTATCT pLKO_005 1080 CDS 100% 4.950 3.465 N Hoxb8 n/a
12 TRCN0000016019 GAGTTCCTATTTAATCCCTAT pLKO.1 1078 CDS 100% 4.050 2.835 N HOXB8 n/a
13 TRCN0000285122 CGGCAATTTCTACGGCTACGA pLKO_005 834 CDS 100% 2.640 1.848 N HOXB8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024016.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.