Transcript: Human NM_024075.5

Homo sapiens tRNA splicing endonuclease subunit 34 (TSEN34), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TSEN34 (79042)
Length:
2214
CDS:
112..1044

Additional Resources:

NCBI RefSeq record:
NM_024075.5
NBCI Gene record:
TSEN34 (79042)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024075.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063656 GCGCTACAGTATCTACAGAGA pLKO.1 768 CDS 100% 2.640 3.696 N TSEN34 n/a
2 TRCN0000288674 GCGCTACAGTATCTACAGAGA pLKO_005 768 CDS 100% 2.640 3.696 N TSEN34 n/a
3 TRCN0000295835 TACCTTTCTCCGCGGTTAGTT pLKO_005 1136 3UTR 100% 0.000 0.000 N TSEN34 n/a
4 TRCN0000063655 CCCATTATATCGCTCAGTGCT pLKO.1 878 CDS 100% 2.640 2.112 N TSEN34 n/a
5 TRCN0000295887 TCCCAAGCAGGACCCTCAAAT pLKO_005 610 CDS 100% 13.200 9.240 N TSEN34 n/a
6 TRCN0000295832 GAGGTGACTTCCTGGTCTATC pLKO_005 833 CDS 100% 10.800 7.560 N TSEN34 n/a
7 TRCN0000295834 GGAGCTCCTGGAGAAGATTAC pLKO_005 441 CDS 100% 10.800 7.560 N TSEN34 n/a
8 TRCN0000063657 GCAAGAGCCTTTCTGGATGTT pLKO.1 1080 3UTR 100% 4.950 3.465 N TSEN34 n/a
9 TRCN0000063654 GCCTGATGGTAAGGTGGTCTA pLKO.1 993 CDS 100% 4.050 2.835 N TSEN34 n/a
10 TRCN0000063653 GCTGCTAAGAAGCAGAAACTA pLKO.1 472 CDS 100% 0.563 0.394 N TSEN34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024075.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12535 pDONR223 100% 79.2% 68.3% None 334C>G;805delA;930_931ins241 n/a
2 ccsbBroad304_12535 pLX_304 0% 79.2% 68.3% V5 334C>G;805delA;930_931ins241 n/a
Download CSV