Transcript: Human NM_024078.3

Homo sapiens nucleolar complex associated 4 homolog (NOC4L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NOC4L (79050)
Length:
1650
CDS:
33..1583

Additional Resources:

NCBI RefSeq record:
NM_024078.3
NBCI Gene record:
NOC4L (79050)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122579 CCTCTGTCTTTCACGTCAAGT pLKO.1 1039 CDS 100% 4.950 6.930 N NOC4L n/a
2 TRCN0000280890 CCTCTGTCTTTCACGTCAAGT pLKO_005 1039 CDS 100% 4.950 6.930 N NOC4L n/a
3 TRCN0000148675 CTCTGTCTTTCACGTCAAGTA pLKO.1 1040 CDS 100% 4.950 3.960 N NOC4L n/a
4 TRCN0000147325 GCTGTTCATCTTGATTCACAA pLKO.1 965 CDS 100% 4.950 3.465 N NOC4L n/a
5 TRCN0000280891 GCTGTTCATCTTGATTCACAA pLKO_005 965 CDS 100% 4.950 3.465 N NOC4L n/a
6 TRCN0000122580 CCTGCCTTTCATCTGTAACCT pLKO.1 1193 CDS 100% 3.000 2.100 N NOC4L n/a
7 TRCN0000280892 CCTGCCTTTCATCTGTAACCT pLKO_005 1193 CDS 100% 3.000 2.100 N NOC4L n/a
8 TRCN0000148982 GATTCACAAACACAACCTGGA pLKO.1 977 CDS 100% 2.160 1.512 N NOC4L n/a
9 TRCN0000280889 GATTCACAAACACAACCTGGA pLKO_005 977 CDS 100% 2.160 1.512 N NOC4L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.