Transcript: Mouse NM_024201.3

Mus musculus coiled-coil domain containing 127 (Ccdc127), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ccdc127 (67433)
Length:
3430
CDS:
97..879

Additional Resources:

NCBI RefSeq record:
NM_024201.3
NBCI Gene record:
Ccdc127 (67433)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024201.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197959 GAACTACTTGTCGAACTTAAA pLKO.1 820 CDS 100% 13.200 18.480 N Ccdc127 n/a
2 TRCN0000337977 CAAGTGGAATTATGCCCTATT pLKO_005 168 CDS 100% 10.800 15.120 N Ccdc127 n/a
3 TRCN0000200082 CCCGCTTCCTATTCCACATTT pLKO.1 2633 3UTR 100% 13.200 9.240 N Ccdc127 n/a
4 TRCN0000198615 CCGCTTCCTATTCCACATTTA pLKO.1 2634 3UTR 100% 13.200 9.240 N Ccdc127 n/a
5 TRCN0000337906 GAAAGTAGAGAAGGTCATATT pLKO_005 849 CDS 100% 13.200 9.240 N Ccdc127 n/a
6 TRCN0000337976 GGAACTACTTGTCGAACTTAA pLKO_005 819 CDS 100% 13.200 9.240 N Ccdc127 n/a
7 TRCN0000337909 TGGCAGCATTTCGTTGGATTT pLKO_005 206 CDS 100% 10.800 7.560 N Ccdc127 n/a
8 TRCN0000176864 GTAGAGAAGGTCATATTAGAA pLKO.1 853 CDS 100% 5.625 3.938 N Ccdc127 n/a
9 TRCN0000176774 CCTGTATTCAATAAGCATGTT pLKO.1 1370 3UTR 100% 4.950 3.465 N Ccdc127 n/a
10 TRCN0000337974 CCTGTATTCAATAAGCATGTT pLKO_005 1370 3UTR 100% 4.950 3.465 N Ccdc127 n/a
11 TRCN0000181501 GCTCATGTGGATGTATCTCAA pLKO.1 792 CDS 100% 4.950 3.465 N Ccdc127 n/a
12 TRCN0000181500 GCAAGTGGAATTATGCCCTAT pLKO.1 167 CDS 100% 4.050 2.835 N Ccdc127 n/a
13 TRCN0000178383 GCTGTGATTACAAGTGTGTAT pLKO.1 1708 3UTR 100% 4.950 2.970 N Ccdc127 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024201.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.