Transcript: Mouse NM_024230.2

Mus musculus smoothelin-like 1 (Smtnl1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Smtnl1 (68678)
Length:
1761
CDS:
163..1542

Additional Resources:

NCBI RefSeq record:
NM_024230.2
NBCI Gene record:
Smtnl1 (68678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112941 CCCAATGAAGTTAGGGAGAAA pLKO.1 529 CDS 100% 4.950 3.960 N Smtnl1 n/a
2 TRCN0000112944 CAGCATCTAAGAGTGGCGAAT pLKO.1 332 CDS 100% 4.050 3.240 N Smtnl1 n/a
3 TRCN0000112943 GAAGGCCATCATGGACAAATT pLKO.1 1104 CDS 100% 13.200 9.240 N Smtnl1 n/a
4 TRCN0000255558 ACCTACATCCAGGAGCTATAC pLKO_005 1477 CDS 100% 10.800 7.560 N Smtnl1 n/a
5 TRCN0000281502 GCACTGTTCCGGAACACAAAG pLKO_005 1150 CDS 100% 10.800 7.560 N Smtnl1 n/a
6 TRCN0000255559 TCAGATTGGGCAGAACATTTG pLKO_005 304 CDS 100% 10.800 7.560 N Smtnl1 n/a
7 TRCN0000112940 AGCAGGTGACACCAGTATCAA pLKO.1 1624 3UTR 100% 5.625 3.938 N Smtnl1 n/a
8 TRCN0000112942 GCACAACTTCACCCTAGCTTT pLKO.1 1365 CDS 100% 4.950 3.465 N Smtnl1 n/a
9 TRCN0000255557 GAGACCAATCTAGAATCTAAG pLKO_005 595 CDS 100% 10.800 6.480 N Smtnl1 n/a
10 TRCN0000265656 ACGAGCACGTGGATATCCAAA pLKO_005 1241 CDS 100% 4.950 2.970 N Smtnl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.