Transcript: Mouse NM_024436.3

Mus musculus RAB22A, member RAS oncogene family (Rab22a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rab22a (19334)
Length:
1909
CDS:
262..846

Additional Resources:

NCBI RefSeq record:
NM_024436.3
NBCI Gene record:
Rab22a (19334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381994 TGTCAGAGTCGTATCAGTAAG pLKO_005 1230 3UTR 100% 10.800 15.120 N Rab22a n/a
2 TRCN0000100831 CCGAATATCAATCCAACCATA pLKO.1 355 CDS 100% 4.950 6.930 N Rab22a n/a
3 TRCN0000302791 CCGAATATCAATCCAACCATA pLKO_005 355 CDS 100% 4.950 6.930 N Rab22a n/a
4 TRCN0000100832 GCAGGGAACAAGTGCGATCTT pLKO.1 607 CDS 100% 4.950 6.930 N Rab22a n/a
5 TRCN0000302790 GCAGGGAACAAGTGCGATCTT pLKO_005 607 CDS 100% 4.950 6.930 N Rab22a n/a
6 TRCN0000376917 ATGGATGGTAGGATTGAATTG pLKO_005 1097 3UTR 100% 10.800 8.640 N Rab22a n/a
7 TRCN0000380076 GACGCCACCTCATGCTCTTTA pLKO_005 919 3UTR 100% 13.200 9.240 N Rab22a n/a
8 TRCN0000100833 GCTGGACAAGAACGATTTCGT pLKO.1 445 CDS 100% 3.000 2.100 N Rab22a n/a
9 TRCN0000302715 GCTGGACAAGAACGATTTCGT pLKO_005 445 CDS 100% 3.000 2.100 N Rab22a n/a
10 TRCN0000100834 CGCAGATTCCATTCATGCCAT pLKO.1 669 CDS 100% 2.640 1.848 N Rab22a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.