Transcript: Human NM_024597.4

Homo sapiens MAP7 domain containing 3 (MAP7D3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MAP7D3 (79649)
Length:
4385
CDS:
43..2673

Additional Resources:

NCBI RefSeq record:
NM_024597.4
NBCI Gene record:
MAP7D3 (79649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024597.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257518 CACTGTACCCTTGCGTAAATG pLKO_005 813 CDS 100% 13.200 18.480 N MAP7D3 n/a
2 TRCN0000246340 CATCACCATTACCACTTATTT pLKO_005 1610 CDS 100% 15.000 12.000 N MAP7D3 n/a
3 TRCN0000257507 ACATCCAGCCATGACATATAT pLKO_005 2245 CDS 100% 15.000 10.500 N MAP7D3 n/a
4 TRCN0000257500 CTATGAAGAGTCTGGTAATAA pLKO_005 1785 CDS 100% 15.000 10.500 N MAP7D3 n/a
5 TRCN0000257502 TCTGACTTGAACCTGGTAAAG pLKO_005 2798 3UTR 100% 10.800 7.560 N MAP7D3 n/a
6 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3382 3UTR 100% 1.080 0.540 Y GPR83 n/a
7 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3382 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024597.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.