Transcript: Human NM_024871.3

Homo sapiens MAP6 domain containing 1 (MAP6D1), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MAP6D1 (79929)
Length:
2105
CDS:
31..630

Additional Resources:

NCBI RefSeq record:
NM_024871.3
NBCI Gene record:
MAP6D1 (79929)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369803 CCGGATTCTCAACGTGTGACT pLKO_005 612 CDS 100% 2.640 3.696 N MAP6D1 n/a
2 TRCN0000172582 GCTGAGTATCCAGGAGGAAAT pLKO.1 1145 3UTR 100% 10.800 7.560 N MAP6D1 n/a
3 TRCN0000369802 CCACGTCGTACAGACAGGAAT pLKO_005 419 CDS 100% 4.950 3.465 N MAP6D1 n/a
4 TRCN0000168077 CCTCAAGATCCACAAAGACAA pLKO.1 464 CDS 100% 4.950 3.465 N MAP6D1 n/a
5 TRCN0000244671 GAGTCATCACAACCCACACTT pLKO_005 494 CDS 100% 4.950 3.465 N MAP6D1 n/a
6 TRCN0000369738 TGAAGCCCTCAAGATCCACAA pLKO_005 458 CDS 100% 4.050 2.835 N MAP6D1 n/a
7 TRCN0000172956 GTGAGGAAGAAGTTCACTCCT pLKO.1 559 CDS 100% 2.640 1.848 N MAP6D1 n/a
8 TRCN0000369773 ATGCGTGAGCACTTGATTAAT pLKO_005 1025 3UTR 100% 15.000 9.000 N MAP6D1 n/a
9 TRCN0000369774 CCCTTGAAAGAACCAGTTATG pLKO_005 980 3UTR 100% 10.800 6.480 N MAP6D1 n/a
10 TRCN0000369772 GGAAGAAGTTCACTCCTAACC pLKO_005 563 CDS 100% 4.050 2.430 N MAP6D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.