Transcript: Human NM_024915.4

Homo sapiens grainyhead like transcription factor 2 (GRHL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GRHL2 (79977)
Length:
5232
CDS:
332..2209

Additional Resources:

NCBI RefSeq record:
NM_024915.4
NBCI Gene record:
GRHL2 (79977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024915.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015811 CGTAGCAATAAACCCATTCAT pLKO.1 1532 CDS 100% 5.625 7.875 N GRHL2 n/a
2 TRCN0000015808 GCCGATTACAAGGAGAGCTTT pLKO.1 1334 CDS 100% 4.950 6.930 N GRHL2 n/a
3 TRCN0000433943 ACGTCTGGGTGCAGTAGTTAT pLKO_005 2648 3UTR 100% 13.200 9.240 N GRHL2 n/a
4 TRCN0000015812 CCAGTGAACCTTTCCCTAAAT pLKO.1 692 CDS 100% 13.200 9.240 N GRHL2 n/a
5 TRCN0000422022 AGACATCAAGTGGCACATTTC pLKO_005 1056 CDS 100% 10.800 7.560 N GRHL2 n/a
6 TRCN0000015809 CCTTCAAAGCAGATGAAAGAA pLKO.1 1907 CDS 100% 5.625 3.938 N GRHL2 n/a
7 TRCN0000015810 GCTGAAGATTTCACACCAGTT pLKO.1 809 CDS 100% 4.050 2.835 N GRHL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024915.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04157 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04157 pLX_304 0% 100% 100% V5 n/a
Download CSV