Transcript: Human NM_024989.4

Homo sapiens post-GPI attachment to proteins inositol deacylase 1 (PGAP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
PGAP1 (80055)
Length:
11090
CDS:
92..2860

Additional Resources:

NCBI RefSeq record:
NM_024989.4
NBCI Gene record:
PGAP1 (80055)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024989.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047154 GCTACCATGTTGGATAAAGAA pLKO.1 1970 CDS 100% 5.625 7.875 N PGAP1 n/a
2 TRCN0000047156 CCCGCATATGAGTTGTATCTT pLKO.1 275 CDS 100% 0.000 0.000 N PGAP1 n/a
3 TRCN0000419787 ACAATTCTCAAACTCTATAAG pLKO_005 548 CDS 100% 13.200 9.240 N PGAP1 n/a
4 TRCN0000415642 TGCTATAGTTTACCTATTAAG pLKO_005 3271 3UTR 100% 13.200 9.240 N PGAP1 n/a
5 TRCN0000047157 CCTCTGAACTTCCTAAAGATA pLKO.1 2244 CDS 100% 5.625 3.938 N PGAP1 n/a
6 TRCN0000047155 CCAAGAAGAAACTGTCAGTTT pLKO.1 1032 CDS 100% 4.950 3.465 N PGAP1 n/a
7 TRCN0000047153 CCAGCTATAATTTCTGACTTA pLKO.1 1100 CDS 100% 4.950 3.465 N PGAP1 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5289 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5289 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024989.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.