Transcript: Human NM_025003.5

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 20 (ADAMTS20), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ADAMTS20 (80070)
Length:
6358
CDS:
283..6015

Additional Resources:

NCBI RefSeq record:
NM_025003.5
NBCI Gene record:
ADAMTS20 (80070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025003.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421611 CATTCGTCAGTACAGCTATTC pLKO_005 2526 CDS 100% 10.800 15.120 N ADAMTS20 n/a
2 TRCN0000050805 CGTGTTAAACTCCAGTGCCAA pLKO.1 2379 CDS 100% 2.640 3.696 N ADAMTS20 n/a
3 TRCN0000050804 GCTATTATCTAAGCACGAATT pLKO.1 4115 CDS 100% 0.000 0.000 N ADAMTS20 n/a
4 TRCN0000426199 GGTGTTGTGTGTGGGTAATTT pLKO_005 2745 CDS 100% 15.000 12.000 N ADAMTS20 n/a
5 TRCN0000050803 GCGAGATGTTAAATGTGTCAA pLKO.1 3576 CDS 100% 4.950 3.960 N ADAMTS20 n/a
6 TRCN0000050806 CCCATCTACTAAGAAACATAA pLKO.1 5136 CDS 100% 13.200 9.240 N ADAMTS20 n/a
7 TRCN0000050807 GCAACATGAATGAAGATCTTA pLKO.1 938 CDS 100% 5.625 3.938 N ADAMTS20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025003.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.