Transcript: Human NM_025057.3

Homo sapiens basal body orientation factor 1 (BBOF1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
BBOF1 (80127)
Length:
3113
CDS:
131..1720

Additional Resources:

NCBI RefSeq record:
NM_025057.3
NBCI Gene record:
BBOF1 (80127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263914 CTTCCAAGTTACCAATCATAT pLKO_005 2559 3UTR 100% 13.200 10.560 N BBOF1 n/a
2 TRCN0000263912 TTGCAAGAGAGTCATACTTTA pLKO_005 887 CDS 100% 13.200 10.560 N BBOF1 n/a
3 TRCN0000263915 ACAAGCTGCTTTCAATTTAAA pLKO_005 1285 CDS 100% 15.000 10.500 N BBOF1 n/a
4 TRCN0000263913 TAGGATTAAGTATCGTGATAC pLKO_005 277 CDS 100% 10.800 7.560 N BBOF1 n/a
5 TRCN0000263916 TGCAGCAACACGCAATGATAG pLKO_005 1068 CDS 100% 10.800 7.560 N BBOF1 n/a
6 TRCN0000166908 CCCAAATATGTCTGTATGTTT pLKO.1 2836 3UTR 100% 5.625 3.938 N BBOF1 n/a
7 TRCN0000172809 GCAGATAGCACAAGCTGCTTT pLKO.1 1276 CDS 100% 4.950 3.465 N BBOF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025057.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.