Transcript: Mouse NM_025346.1

Mus musculus required for meiotic nuclear division 5 homolog B (Rmnd5b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rmnd5b (66089)
Length:
1946
CDS:
355..1536

Additional Resources:

NCBI RefSeq record:
NM_025346.1
NBCI Gene record:
Rmnd5b (66089)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039449 GCTTCCGACCATAAGGACATT pLKO.1 580 CDS 100% 4.950 6.930 N Rmnd5b n/a
2 TRCN0000039450 CACAAGGATGAGTTGCCGATT pLKO.1 1300 CDS 100% 4.050 5.670 N Rmnd5b n/a
3 TRCN0000287660 CACAAGGATGAGTTGCCGATT pLKO_005 1300 CDS 100% 4.050 5.670 N Rmnd5b n/a
4 TRCN0000295081 CCCGTGCTGATGAACATTAAA pLKO_005 1240 CDS 100% 15.000 10.500 N Rmnd5b n/a
5 TRCN0000307488 CAAAGGTCTTGGTCATCAAAT pLKO_005 1760 3UTR 100% 13.200 9.240 N Rmnd5b n/a
6 TRCN0000295080 CAGATGGGAAACGCATCATAT pLKO_005 1511 CDS 100% 13.200 9.240 N Rmnd5b n/a
7 TRCN0000033908 GCAGATGGGAAACGCATCATA pLKO.1 1510 CDS 100% 5.625 3.938 N RMND5B n/a
8 TRCN0000331114 GCAGATGGGAAACGCATCATA pLKO_005 1510 CDS 100% 5.625 3.938 N RMND5B n/a
9 TRCN0000039452 CTTGGAGTTGAATCGGATCTT pLKO.1 822 CDS 100% 4.950 3.465 N Rmnd5b n/a
10 TRCN0000306708 CTTGGAGTTGAATCGGATCTT pLKO_005 822 CDS 100% 4.950 3.465 N Rmnd5b n/a
11 TRCN0000039453 TCATCAATGGAGGAAAGCTAA pLKO.1 1457 CDS 100% 4.950 3.465 N Rmnd5b n/a
12 TRCN0000039451 CCTGCACAAGTTCCTAACCTA pLKO.1 396 CDS 100% 3.000 2.100 N Rmnd5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.