Transcript: Mouse NM_025358.3

Mus musculus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 (Ndufa9), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Ndufa9 (66108)
Length:
1322
CDS:
33..1166

Additional Resources:

NCBI RefSeq record:
NM_025358.3
NBCI Gene record:
Ndufa9 (66108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025358.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041544 CCTGGGTCGATACGTTGTTAA pLKO.1 224 CDS 100% 13.200 18.480 N Ndufa9 n/a
2 TRCN0000324573 CCTGGGTCGATACGTTGTTAA pLKO_005 224 CDS 100% 13.200 18.480 N Ndufa9 n/a
3 TRCN0000041543 CGGTGTATGTTGCAGATGTTT pLKO.1 748 CDS 100% 5.625 4.500 N Ndufa9 n/a
4 TRCN0000041545 CCTTACCCTTTGCCACTATTT pLKO.1 900 CDS 100% 13.200 9.240 N Ndufa9 n/a
5 TRCN0000324493 CCTTACCCTTTGCCACTATTT pLKO_005 900 CDS 100% 13.200 9.240 N Ndufa9 n/a
6 TRCN0000041546 GCCAGCTTACCTTTCTGGAAT pLKO.1 334 CDS 100% 4.950 3.465 N Ndufa9 n/a
7 TRCN0000324576 GCCAGCTTACCTTTCTGGAAT pLKO_005 334 CDS 100% 4.950 3.465 N Ndufa9 n/a
8 TRCN0000041547 CCTCTTGTTTCTTTGGGCTTT pLKO.1 711 CDS 100% 4.050 2.835 N Ndufa9 n/a
9 TRCN0000353863 CCTCTTGTTTCTTTGGGCTTT pLKO_005 711 CDS 100% 4.050 2.835 N Ndufa9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025358.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.