Transcript: Mouse NM_025382.6

Mus musculus transmembrane protein 57 (Tmem57), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmem57 (66146)
Length:
3842
CDS:
229..2223

Additional Resources:

NCBI RefSeq record:
NM_025382.6
NBCI Gene record:
Tmem57 (66146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025382.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422894 TGATTCCATAGCTGCATTAAA pLKO_005 2659 3UTR 100% 15.000 21.000 N Tmem57 n/a
2 TRCN0000412925 ATAACATCCAAGTCTGATTAG pLKO_005 2355 3UTR 100% 10.800 15.120 N Tmem57 n/a
3 TRCN0000126372 CCAGAGATAGAATATCGAGAA pLKO.1 970 CDS 100% 4.050 5.670 N Tmem57 n/a
4 TRCN0000416420 AGATACAAGAGATTGAGTATA pLKO_005 1073 CDS 100% 13.200 9.240 N Tmem57 n/a
5 TRCN0000418070 GGTATCTACGGCAGTACATTT pLKO_005 295 CDS 100% 13.200 9.240 N Tmem57 n/a
6 TRCN0000126373 CCAGCTAGAGAAGAAGCTAAA pLKO.1 1590 CDS 100% 10.800 7.560 N Tmem57 n/a
7 TRCN0000126370 CCAGGAAATCAAGGACCTAAA pLKO.1 2040 CDS 100% 10.800 7.560 N Tmem57 n/a
8 TRCN0000416377 TTGTCCTCCTTGCCGACTTTG pLKO_005 347 CDS 100% 10.800 7.560 N Tmem57 n/a
9 TRCN0000126369 CGTGCCATTTACTGCTTTCTT pLKO.1 3087 3UTR 100% 5.625 3.938 N Tmem57 n/a
10 TRCN0000126371 CGTCTATGATTCCTTCAGATA pLKO.1 420 CDS 100% 4.950 3.465 N Tmem57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025382.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.