Transcript: Mouse NM_025386.3

Mus musculus F-box protein 36 (Fbxo36), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fbxo36 (66153)
Length:
900
CDS:
33..599

Additional Resources:

NCBI RefSeq record:
NM_025386.3
NBCI Gene record:
Fbxo36 (66153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177735 CGCCGTAGTATTTGGTACAAA pLKO.1 245 CDS 100% 5.625 7.875 N Fbxo36 n/a
2 TRCN0000293026 CGCCGTAGTATTTGGTACAAA pLKO_005 245 CDS 100% 5.625 7.875 N Fbxo36 n/a
3 TRCN0000177734 CGGACTCAGATCATCTTTAGA pLKO.1 120 CDS 100% 5.625 4.500 N Fbxo36 n/a
4 TRCN0000292964 CGGACTCAGATCATCTTTAGA pLKO_005 120 CDS 100% 5.625 4.500 N Fbxo36 n/a
5 TRCN0000182361 GCTGAAGATCATCTGCTACCT pLKO.1 338 CDS 100% 2.640 1.848 N Fbxo36 n/a
6 TRCN0000182331 GCTGCTGAAGATCATCTGCTA pLKO.1 335 CDS 100% 2.640 1.848 N Fbxo36 n/a
7 TRCN0000293028 GCTGCTGAAGATCATCTGCTA pLKO_005 335 CDS 100% 2.640 1.848 N Fbxo36 n/a
8 TRCN0000178641 CCAAAGCTCACTCTCTCTTAA pLKO.1 649 3UTR 100% 13.200 7.920 N Fbxo36 n/a
9 TRCN0000292963 CCAAAGCTCACTCTCTCTTAA pLKO_005 649 3UTR 100% 13.200 7.920 N Fbxo36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025386.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.