Transcript: Mouse NM_025434.3

Mus musculus mitochondrial ribosomal protein S28 (Mrps28), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mrps28 (66230)
Length:
738
CDS:
62..622

Additional Resources:

NCBI RefSeq record:
NM_025434.3
NBCI Gene record:
Mrps28 (66230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322397 AGATGTGGATGGCGAGAAATA pLKO_005 439 CDS 100% 13.200 9.240 N Mrps28 n/a
2 TRCN0000191410 CTTGCTGTATTTGAACCCATT pLKO.1 632 3UTR 100% 4.050 2.835 N Mrps28 n/a
3 TRCN0000322396 CTTGCTGTATTTGAACCCATT pLKO_005 632 3UTR 100% 4.050 2.835 N Mrps28 n/a
4 TRCN0000201604 CCAAGCCTTTGCGAAATGCAA pLKO.1 129 CDS 100% 3.000 2.100 N Mrps28 n/a
5 TRCN0000322395 CCAAGCCTTTGCGAAATGCAA pLKO_005 129 CDS 100% 3.000 2.100 N Mrps28 n/a
6 TRCN0000201326 GCTTGCTGTATTTGAACCCAT pLKO.1 631 3UTR 100% 2.640 1.848 N Mrps28 n/a
7 TRCN0000190345 CCAAGAGATCAGGGACTCAAA pLKO.1 574 CDS 100% 4.950 2.970 N Mrps28 n/a
8 TRCN0000322332 CCAAGAGATCAGGGACTCAAA pLKO_005 574 CDS 100% 4.950 2.970 N Mrps28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.