Transcript: Mouse NM_025441.3

Mus musculus nuclear export mediator factor (Nemf), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Nemf (66244)
Length:
3737
CDS:
68..3262

Additional Resources:

NCBI RefSeq record:
NM_025441.3
NBCI Gene record:
Nemf (66244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127452 GCTAGGAATGAGAGTAAACAA pLKO.1 130 CDS 100% 5.625 7.875 N Nemf n/a
2 TRCN0000150512 GCTAGGAATGAGAGTAAACAA pLKO.1 130 CDS 100% 5.625 7.875 N NEMF n/a
3 TRCN0000326857 GCTAGGAATGAGAGTAAACAA pLKO_005 130 CDS 100% 5.625 7.875 N Nemf n/a
4 TRCN0000127451 GCTGAAGACATACTCACGTAT pLKO.1 857 CDS 100% 4.950 3.960 N Nemf n/a
5 TRCN0000306406 TCAATGGAAAGGGCTATATAA pLKO_005 792 CDS 100% 15.000 10.500 N Nemf n/a
6 TRCN0000127450 GCTGCTTATCACTTAATCATT pLKO.1 389 CDS 100% 5.625 3.938 N Nemf n/a
7 TRCN0000326789 GCTGCTTATCACTTAATCATT pLKO_005 389 CDS 100% 5.625 3.938 N Nemf n/a
8 TRCN0000127453 GTGGATAACAAGACATATCTT pLKO.1 161 CDS 100% 5.625 3.938 N Nemf n/a
9 TRCN0000326856 GTGGATAACAAGACATATCTT pLKO_005 161 CDS 100% 5.625 3.938 N Nemf n/a
10 TRCN0000127449 GCCAGCATTGAGAACAGTGAT pLKO.1 1343 CDS 100% 4.950 3.465 N Nemf n/a
11 TRCN0000306407 TCAACGATGCAGACGTGTTAA pLKO_005 3313 3UTR 100% 13.200 6.600 Y Nemf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.