Transcript: Mouse NM_025480.3

Mus musculus transmembrane protein 128 (Tmem128), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Tmem128 (66309)
Length:
1085
CDS:
28..519

Additional Resources:

NCBI RefSeq record:
NM_025480.3
NBCI Gene record:
Tmem128 (66309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126687 TCCATCGTTGTGACCTATTAT pLKO.1 196 CDS 100% 15.000 21.000 N Tmem128 n/a
2 TRCN0000332249 TCCATCGTTGTGACCTATTAT pLKO_005 196 CDS 100% 15.000 21.000 N Tmem128 n/a
3 TRCN0000126688 CCTCTTCCAAGACTTAACATT pLKO.1 151 CDS 100% 5.625 7.875 N Tmem128 n/a
4 TRCN0000332248 CCTCTTCCAAGACTTAACATT pLKO_005 151 CDS 100% 5.625 7.875 N Tmem128 n/a
5 TRCN0000126685 CGTGGGATTGAAGAATATGAT pLKO.1 340 CDS 100% 5.625 7.875 N Tmem128 n/a
6 TRCN0000306365 TTTGGCGGAGCCTTGTTATTT pLKO_005 271 CDS 100% 15.000 12.000 N Tmem128 n/a
7 TRCN0000126684 GCTGTCGAAATCAGAATAAAT pLKO.1 655 3UTR 100% 15.000 10.500 N Tmem128 n/a
8 TRCN0000332247 GCTGTCGAAATCAGAATAAAT pLKO_005 655 3UTR 100% 15.000 10.500 N Tmem128 n/a
9 TRCN0000306304 TTCATCTCACTCCTCGGATAA pLKO_005 499 CDS 100% 10.800 7.560 N Tmem128 n/a
10 TRCN0000126686 GCATCCATCGTTGTGACCTAT pLKO.1 193 CDS 100% 4.950 3.465 N Tmem128 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04468 pDONR223 100% 69.5% 70.4% None (many diffs) n/a
2 ccsbBroad304_04468 pLX_304 0% 69.5% 70.4% V5 (many diffs) n/a
Download CSV