Transcript: Mouse NM_025481.2

Mus musculus SMAD specific E3 ubiquitin protein ligase 2 (Smurf2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Smurf2 (66313)
Length:
5346
CDS:
484..2730

Additional Resources:

NCBI RefSeq record:
NM_025481.2
NBCI Gene record:
Smurf2 (66313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422902 ACGAGTGCCTAGGGATCTTAG pLKO_005 1329 CDS 100% 10.800 15.120 N Smurf2 n/a
2 TRCN0000027749 CCACACTTGCTTCAATCGAAT pLKO.1 2622 CDS 100% 4.950 6.930 N Smurf2 n/a
3 TRCN0000027753 CGCAACAGGAAGAGTTTATTT pLKO.1 1407 CDS 100% 15.000 12.000 N Smurf2 n/a
4 TRCN0000027680 CCAGACCTTCATAATAGTTTA pLKO.1 2062 CDS 100% 13.200 10.560 N Smurf2 n/a
5 TRCN0000027747 GCCAAGATACAAGCGAGATTT pLKO.1 1578 CDS 100% 13.200 10.560 N Smurf2 n/a
6 TRCN0000426727 TCCGTCTTCCTGATCCATTTG pLKO_005 572 CDS 100% 10.800 8.640 N Smurf2 n/a
7 TRCN0000003478 CCACCCTATGAAAGCTATGAA pLKO.1 2650 CDS 100% 5.625 3.375 N SMURF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025481.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03961 pDONR223 100% 92% 99.1% None (many diffs) n/a
2 ccsbBroad304_03961 pLX_304 26.9% 92% 99.1% V5 (many diffs) n/a
Download CSV