Transcript: Mouse NM_025496.1

Mus musculus CMT1A duplicated region transcript 4 (Cdrt4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cdrt4 (66338)
Length:
723
CDS:
102..641

Additional Resources:

NCBI RefSeq record:
NM_025496.1
NBCI Gene record:
Cdrt4 (66338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246747 ACATTGGACTCCCTCTGATAC pLKO_005 205 CDS 100% 10.800 15.120 N Cdrt4 n/a
2 TRCN0000246750 AGTAAAGCGCAGCAAACATAG pLKO_005 353 CDS 100% 10.800 15.120 N Cdrt4 n/a
3 TRCN0000184803 CAGTAACCCGAATCACCGAAA pLKO.1 277 CDS 100% 4.050 5.670 N Cdrt4 n/a
4 TRCN0000184099 CCTGCACAACTCCAAATGGAT pLKO.1 504 CDS 100% 3.000 4.200 N Cdrt4 n/a
5 TRCN0000246749 AGGGACCTAGAGTACATTTAT pLKO_005 309 CDS 100% 15.000 10.500 N Cdrt4 n/a
6 TRCN0000246751 GGGAATGCTCCACCATATATG pLKO_005 460 CDS 100% 13.200 9.240 N Cdrt4 n/a
7 TRCN0000246748 AGAACCTGCACAACTCCAAAT pLKO_005 500 CDS 100% 10.800 7.560 N Cdrt4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.