Transcript: Mouse NM_025675.4

Mus musculus diphthamine biosynthesis 6 (Dph6), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dph6 (66632)
Length:
2700
CDS:
76..879

Additional Resources:

NCBI RefSeq record:
NM_025675.4
NBCI Gene record:
Dph6 (66632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025675.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251057 GACAATCAAGCTCGTTGTAAT pLKO_005 1743 3UTR 100% 13.200 18.480 N Dph6 n/a
2 TRCN0000251056 GATGAAACAGCTAACTCTATA pLKO_005 847 CDS 100% 13.200 18.480 N Dph6 n/a
3 TRCN0000251060 GGGTATCAGTAGGTGCTATAC pLKO_005 407 CDS 100% 10.800 8.640 N Dph6 n/a
4 TRCN0000251058 TCTAATATCAAGGCCATTATC pLKO_005 541 CDS 100% 13.200 9.240 N Dph6 n/a
5 TRCN0000251059 CAGATGAACTGGATAGCTATA pLKO_005 200 CDS 100% 10.800 7.560 N Dph6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025675.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04502 pDONR223 100% 85.5% 87.6% None (many diffs) n/a
2 ccsbBroad304_04502 pLX_304 0% 85.5% 87.6% V5 (many diffs) n/a
3 TRCN0000467870 GACCCTCCCGTTTGTGAAGTCACG pLX_317 42.6% 85.5% 87.6% V5 (many diffs) n/a
Download CSV