Construct: ORF TRCN0000467870
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010706.1_s317c1
- Derived from:
- ccsbBroadEn_04502
- DNA Barcode:
- GACCCTCCCGTTTGTGAAGTCACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DPH6 (89978)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467870
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | NM_080650.4 | 100% | 100% | |
| 2 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | XM_011522160.2 | 94.7% | 93.6% | 752_752delGins22;760G>T;762_762delAinsTAATTATATATATAATTTT |
| 3 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | XM_017022708.2 | 92.9% | 88.7% | (many diffs) |
| 4 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | XM_017022707.2 | 90.3% | 88.9% | (many diffs) |
| 5 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | XR_001751411.2 | 79.5% | 1_52del;619_620ins95;759_792del | |
| 6 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | XR_001751413.2 | 76.3% | (many diffs) | |
| 7 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | XM_017022709.2 | 74.5% | 71.9% | 567_568ins95;597_598ins109 |
| 8 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | NM_001141972.2 | 51.7% | 44.1% | (many diffs) |
| 9 | human | 89978 | DPH6 | diphthamine biosynthesis 6 | XR_001751412.2 | 35.9% | (many diffs) | |
| 10 | mouse | 66632 | Dph6 | diphthamine biosynthesis 6 | NM_025675.4 | 85.5% | 87.6% | (many diffs) |
| 11 | mouse | 66632 | Dph6 | diphthamine biosynthesis 6 | XM_006500018.3 | 63.6% | 52.3% | (many diffs) |
| 12 | mouse | 66632 | Dph6 | diphthamine biosynthesis 6 | XR_866334.2 | 53.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 867
- ORF length:
- 801
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ggtcgcggct ctgatcagtg gtgggaagga cagctgctat aatatgatgc 121 agtgcattgc tgctgggcat cagatcgttg ctttagcaaa tctaagacca gctgaaaacc 181 aagtggggtc tgatgaactg gatagctaca tgtatcagac agtggggcac catgccattg 241 acttgtatgc agaagcaatg gctcttcccc tctatcgccg aaccataaga ggaaggagct 301 tggatacaag acaagtgtac accaaatgtg aaggtgatga ggttgaagat ctctatgagc 361 ttttgaaact tgttaaggaa aaagaagaag tagaggggat atcagtaggt gctatacttt 421 ctgactatca gcgtattcga gtggaaaatg tgtgtaaaag gcttaatctc cagcctttag 481 cttatctttg gcagagaaac caggaagatt tgctcagaga gatgataTCA TCTAACATTC 541 AAGCAATGAT CATCAAAGTA GCAGCTTTGG GTTTAGATCC TGATAAGCAT CTTGGGAAAA 601 CCCTGGATCA AATGGAGCCT TATCTCATAG AGCTTTCTAA GAAGTATGGA GTACATGTTT 661 GTGGAGAAGG TGGAGAGTAT GAAACTTTCA CTTTGGATTG CCCTCTATTT AAGAAGAAAA 721 TAATTGTGGA TTCATCAGAA GTAGTCATAC ATTCAGCTGA TGCATTTGCA CCTGTGGCTT 781 ATCTACGCTT TTTAGAATTG CACTTGGAGG ACAAGGTGTC CTCAGTGCCT GACAACTACA 841 GAACATCTAA TTATATATAT AATTTTTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 901 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 961 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGACCCTCC 1021 CGTTTGTGAA GTCACGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1081 aagatt