Transcript: Mouse NM_025680.4

Mus musculus catenin, beta like 1 (Ctnnbl1), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Ctnnbl1 (66642)
Length:
2731
CDS:
130..1821

Additional Resources:

NCBI RefSeq record:
NM_025680.4
NBCI Gene record:
Ctnnbl1 (66642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025680.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123610 CGGATCAAGTTTCCAGACAAT pLKO.1 427 CDS 100% 4.950 6.930 N Ctnnbl1 n/a
2 TRCN0000353791 CGGATCAAGTTTCCAGACAAT pLKO_005 427 CDS 100% 4.950 6.930 N Ctnnbl1 n/a
3 TRCN0000123611 CCCTAGCTATTGTGGAGAATA pLKO.1 782 CDS 100% 13.200 9.240 N Ctnnbl1 n/a
4 TRCN0000332025 CCCTAGCTATTGTGGAGAATA pLKO_005 782 CDS 100% 13.200 9.240 N Ctnnbl1 n/a
5 TRCN0000123609 CCTGTGCTTCTGTCTTCAAAT pLKO.1 2156 3UTR 100% 13.200 9.240 N Ctnnbl1 n/a
6 TRCN0000123612 ACAGCACATCTGTTACATCAT pLKO.1 1608 CDS 100% 4.950 3.465 N Ctnnbl1 n/a
7 TRCN0000332093 ACAGCACATCTGTTACATCAT pLKO_005 1608 CDS 100% 4.950 3.465 N Ctnnbl1 n/a
8 TRCN0000123613 CAGGCACATCATCAAGGAGTA pLKO.1 1716 CDS 100% 4.050 2.835 N Ctnnbl1 n/a
9 TRCN0000332092 CAGGCACATCATCAAGGAGTA pLKO_005 1716 CDS 100% 4.050 2.835 N Ctnnbl1 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2559 3UTR 100% 4.050 2.025 Y Mtif2 n/a
11 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 332 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025680.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12299 pDONR223 100% 49.7% 53.6% None (many diffs) n/a
Download CSV