Transcript: Mouse NM_025693.4

Mus musculus transmembrane protein 41a (Tmem41a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem41a (66664)
Length:
1359
CDS:
67..861

Additional Resources:

NCBI RefSeq record:
NM_025693.4
NBCI Gene record:
Tmem41a (66664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125666 GCTCATCGGTTTGATCCCTTA pLKO.1 633 CDS 100% 4.050 5.670 N Tmem41a n/a
2 TRCN0000323846 GCTCATCGGTTTGATCCCTTA pLKO_005 633 CDS 100% 4.050 5.670 N Tmem41a n/a
3 TRCN0000125667 GAACCGAAACAGCCTGTTCTT pLKO.1 510 CDS 100% 4.950 3.960 N Tmem41a n/a
4 TRCN0000374687 TCTTCGAGAGTACCGGAAAGA pLKO_005 237 CDS 100% 4.950 3.960 N Tmem41a n/a
5 TRCN0000311388 AGCTGGTCATCTCCTACTTTC pLKO_005 452 CDS 100% 10.800 7.560 N Tmem41a n/a
6 TRCN0000305682 GTTCCGGGAACGCTCATCAAA pLKO_005 766 CDS 100% 5.625 3.938 N Tmem41a n/a
7 TRCN0000141121 CATGACACCAAACTGGTTCTT pLKO.1 558 CDS 100% 4.950 3.465 N TMEM41A n/a
8 TRCN0000297934 CATGACACCAAACTGGTTCTT pLKO_005 558 CDS 100% 4.950 3.465 N TMEM41A n/a
9 TRCN0000125664 CCCTGAGATGTCTTGGAAGAT pLKO.1 1076 3UTR 100% 4.950 3.465 N Tmem41a n/a
10 TRCN0000323916 CCCTGAGATGTCTTGGAAGAT pLKO_005 1076 3UTR 100% 4.950 3.465 N Tmem41a n/a
11 TRCN0000125665 GCTGAGTGAAACAAGCGACAT pLKO.1 810 CDS 100% 4.050 2.835 N Tmem41a n/a
12 TRCN0000374756 TTTGCTGTGCTGCGTGTTGAC pLKO_005 381 CDS 100% 4.050 2.835 N Tmem41a n/a
13 TRCN0000125668 CCTTCGCATTATACCTGCTCT pLKO.1 110 CDS 100% 2.640 1.848 N Tmem41a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09294 pDONR223 99.3% 84.3% 89% None (many diffs) n/a
Download CSV