Transcript: Mouse NM_025698.1

Mus musculus transmembrane p24 trafficking protein 7 (Tmed7), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Tmed7 (66676)
Length:
3452
CDS:
254..928

Additional Resources:

NCBI RefSeq record:
NM_025698.1
NBCI Gene record:
Tmed7 (66676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376323 ACCTTCACAGCCTCCAGAAAT pLKO_005 542 CDS 100% 13.200 9.240 N Tmed7 n/a
2 TRCN0000346459 ACCTTCGAGCTGCCCGATAAT pLKO_005 365 CDS 100% 13.200 9.240 N Tmed7 n/a
3 TRCN0000346461 CATTGACTATCAGACACATTT pLKO_005 736 CDS 100% 13.200 9.240 N Tmed7 n/a
4 TRCN0000346385 GCCGAGCAGAGGATCTGAATA pLKO_005 783 CDS 100% 13.200 9.240 N Tmed7 n/a
5 TRCN0000346386 ATGTACTCTTCCTACACTAAC pLKO_005 1166 3UTR 100% 10.800 7.560 N Tmed7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03173 pDONR223 100% 90.3% 95.9% None (many diffs) n/a
2 ccsbBroad304_03173 pLX_304 0% 90.3% 95.9% V5 (many diffs) n/a
3 TRCN0000473021 CGACTCCACAACAGGGAATAATTT pLX_317 77.4% 90.3% 95.9% V5 (many diffs) n/a
Download CSV