Transcript: Mouse NM_025759.3

Mus musculus spermatogenesis associated glutamate (E)-rich protein 4D (Speer4d), mRNA.

Source:
NCBI, updated 2015-06-25
Taxon:
Mus musculus (mouse)
Gene:
Speer4d (360220)
Length:
1159
CDS:
167..805

Additional Resources:

NCBI RefSeq record:
NM_025759.3
NBCI Gene record:
Speer4d (360220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248368 CCATCTCCAGCACCTACAATC pLKO_005 757 CDS 100% 10.800 6.480 N Speer4d n/a
2 TRCN0000215597 GATGAATCTTCTTCCATATAA pLKO.1 785 CDS 100% 15.000 7.500 Y Speer4d n/a
3 TRCN0000248365 GATGAATCTTCTTCCATATAA pLKO_005 785 CDS 100% 15.000 7.500 Y Speer4d n/a
4 TRCN0000216423 GATGGAGGAGAATCTTATAAA pLKO.1 499 CDS 100% 15.000 7.500 Y Speer4d n/a
5 TRCN0000248367 TGATGGAGGAGAATCTTATAA pLKO_005 498 CDS 100% 15.000 7.500 Y Speer4d n/a
6 TRCN0000255105 CAATCTTGAGACTCCAGAATA pLKO_005 637 CDS 100% 13.200 6.600 Y Speer4e n/a
7 TRCN0000255104 CCTGATGGAGGAGAATCTTAT pLKO_005 496 CDS 100% 13.200 6.600 Y Speer4e n/a
8 TRCN0000255101 GAGAAGGAGATCATGACATTT pLKO_005 380 CDS 100% 13.200 6.600 Y Speer4e n/a
9 TRCN0000248369 GCTCAAGAAGGAGACACATTT pLKO_005 451 CDS 100% 13.200 6.600 Y Speer4d n/a
10 TRCN0000255103 AGGCTGATTGGGCCATCATTC pLKO_005 561 CDS 100% 10.800 5.400 Y Speer4e n/a
11 TRCN0000248366 CTTAGGGTGAATAGGCCTTTA pLKO_005 814 3UTR 100% 10.800 5.400 Y Speer4d n/a
12 TRCN0000175456 CCAGAATATCAGGTCTCAGAA pLKO.1 650 CDS 100% 4.950 2.475 Y Speer4d n/a
13 TRCN0000179250 GAGACAAATGAGCTGAGAGAT pLKO.1 275 CDS 100% 4.950 2.475 Y Gm9758 n/a
14 TRCN0000183327 GATCATGACATTTCTACACAA pLKO.1 388 CDS 100% 4.950 2.475 Y Gm9758 n/a
15 TRCN0000176051 GCAGTTTGAGAAGGAAGAGAA pLKO.1 220 CDS 100% 4.950 2.475 Y Speer4d n/a
16 TRCN0000183289 GTCATAAGCAAGAAGCAGTTT pLKO.1 206 CDS 100% 4.950 2.475 Y Gm9758 n/a
17 TRCN0000270314 GAGAAGGAGATCATGACATAT pLKO_005 380 CDS 100% 13.200 6.600 Y Gm10220 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025759.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.