Transcript: Mouse NM_025779.3

Mus musculus mitochondrial calcium uniporter dominant negative beta subunit (Mcub), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mcub (66815)
Length:
1332
CDS:
132..1169

Additional Resources:

NCBI RefSeq record:
NM_025779.3
NBCI Gene record:
Mcub (66815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340568 TTGTCGACAGTAGGCTCATTC pLKO_005 426 CDS 100% 10.800 15.120 N Mcub n/a
2 TRCN0000175677 GTCCTTGGTTCACAGACTATT pLKO.1 653 CDS 100% 13.200 9.240 N Mcub n/a
3 TRCN0000340489 GTCCTTGGTTCACAGACTATT pLKO_005 653 CDS 100% 13.200 9.240 N Mcub n/a
4 TRCN0000215568 GAACAATACAACAAGCTAAAG pLKO.1 1056 CDS 100% 10.800 7.560 N Mcub n/a
5 TRCN0000194008 GTTACCTTCTTCCTGTCGTTT pLKO.1 909 CDS 100% 4.950 3.465 N Mcub n/a
6 TRCN0000174454 CATCATTAACAAACTACGGTA pLKO.1 566 CDS 100% 2.640 1.848 N Mcub n/a
7 TRCN0000193898 CTGATAGCTTACCAACTGGAT pLKO.1 1205 3UTR 100% 2.640 1.848 N Mcub n/a
8 TRCN0000340566 CTGATAGCTTACCAACTGGAT pLKO_005 1205 3UTR 100% 2.640 1.848 N Mcub n/a
9 TRCN0000173160 CCAGTTTGTAGTCAAGCCGAT pLKO.1 404 CDS 100% 2.160 1.512 N Mcub n/a
10 TRCN0000216185 CTTCAGTTCTTCCACAAGAAA pLKO.1 1011 CDS 100% 0.563 0.394 N Mcub n/a
11 TRCN0000340490 TAACAAACTACGGTATGATAT pLKO_005 572 CDS 100% 13.200 7.920 N Mcub n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.