Transcript: Mouse NM_025790.2

Mus musculus acyl-CoA thioesterase 13 (Acot13), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Acot13 (66834)
Length:
686
CDS:
184..606

Additional Resources:

NCBI RefSeq record:
NM_025790.2
NBCI Gene record:
Acot13 (66834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025790.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195866 CGTACATGTCACCTGCTAAGA pLKO.1 449 CDS 100% 4.950 6.930 N Acot13 n/a
2 TRCN0000417637 ATAAACTGGGCACGCTCCATG pLKO_005 332 CDS 100% 4.050 5.670 N Acot13 n/a
3 TRCN0000179396 GTTATGTTCAAAGTTCCCGGT pLKO.1 223 CDS 100% 0.540 0.432 N Acot13 n/a
4 TRCN0000424762 CAGTGTGGACATGAACATAAC pLKO_005 429 CDS 100% 10.800 7.560 N Acot13 n/a
5 TRCN0000425219 AGAAGTAATGAAGGTTATGTT pLKO_005 210 CDS 100% 5.625 3.938 N Acot13 n/a
6 TRCN0000442927 AGGTGGAAGAGCAGCATACTA pLKO_005 311 CDS 100% 5.625 3.938 N Acot13 n/a
7 TRCN0000183595 GAAACTAATCTGTGAGATGAA pLKO.1 291 CDS 100% 4.950 3.465 N Acot13 n/a
8 TRCN0000414764 GATAGGAGAAGAAATAGTGAT pLKO_005 468 CDS 100% 4.950 3.465 N Acot13 n/a
9 TRCN0000179310 GAAAGACACTTGCATTTGCCT pLKO.1 512 CDS 100% 0.750 0.525 N Acot13 n/a
10 TRCN0000439023 CATCTCGACCATGGCTCTAAT pLKO_005 381 CDS 100% 13.200 7.920 N Acot13 n/a
11 TRCN0000439287 CATTTGCCTCAGTGGATCTGA pLKO_005 524 CDS 100% 3.000 1.800 N Acot13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025790.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.