Transcript: Mouse NM_025806.2

Mus musculus phospholipase B domain containing 1 (Plbd1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Plbd1 (66857)
Length:
1974
CDS:
215..1867

Additional Resources:

NCBI RefSeq record:
NM_025806.2
NBCI Gene record:
Plbd1 (66857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264992 TACACATGTACGACCACTTCA pLKO_005 552 CDS 100% 4.950 6.930 N Plbd1 n/a
2 TRCN0000191000 CCATGAAATATATCATGCGAT pLKO.1 1563 CDS 100% 0.264 0.370 N Plbd1 n/a
3 TRCN0000264993 ACCCACAGCTGTTCAAGAATC pLKO_005 582 CDS 100% 10.800 8.640 N Plbd1 n/a
4 TRCN0000190540 GCCACTGTTCTGCTCTTATTA pLKO.1 894 CDS 100% 15.000 10.500 N Plbd1 n/a
5 TRCN0000216804 GCCATGCTCAGGATCTATAAA pLKO.1 974 CDS 100% 15.000 10.500 N Plbd1 n/a
6 TRCN0000190271 CCTGTCCAATGAGATCATCAT pLKO.1 493 CDS 100% 4.950 3.465 N Plbd1 n/a
7 TRCN0000264989 CTACCTCACTGCTCTACACAT pLKO_005 538 CDS 100% 4.950 3.465 N Plbd1 n/a
8 TRCN0000264991 TTCAAGAATCCTTCCATTGTG pLKO_005 593 CDS 100% 4.950 3.465 N Plbd1 n/a
9 TRCN0000264990 GACCACTTCACGAACCTGTAC pLKO_005 563 CDS 100% 4.050 2.835 N Plbd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.