Transcript: Mouse NM_025807.3

Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 9 (Slc16a9), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc16a9 (66859)
Length:
3563
CDS:
141..1667

Additional Resources:

NCBI RefSeq record:
NM_025807.3
NBCI Gene record:
Slc16a9 (66859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079599 CCACGCCTATGGAATACTCAT pLKO.1 1421 CDS 100% 4.950 6.930 N Slc16a9 n/a
2 TRCN0000079602 CAGACCTATGACATCGCCTTT pLKO.1 1506 CDS 100% 4.050 5.670 N Slc16a9 n/a
3 TRCN0000079598 CGGTCCATAAGATGTGGGAAA pLKO.1 2619 3UTR 100% 4.050 5.670 N Slc16a9 n/a
4 TRCN0000079601 CGAAGATAAATGCTTGCCCAA pLKO.1 842 CDS 100% 2.160 3.024 N Slc16a9 n/a
5 TRCN0000038649 CCCAATATCTACTTTCTGTTT pLKO.1 438 CDS 100% 4.950 3.960 N SLC16A9 n/a
6 TRCN0000079600 CGCCTATGGAATACTCATGTT pLKO.1 1424 CDS 100% 4.950 3.465 N Slc16a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16127 pDONR223 0% 82.1% 87.4% None (many diffs) n/a
2 ccsbBroad304_16127 pLX_304 0% 82.1% 87.4% V5 (many diffs) n/a
Download CSV