Transcript: Mouse NM_025831.3

Mus musculus PX domain containing 1 (Pxdc1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pxdc1 (66895)
Length:
1872
CDS:
247..942

Additional Resources:

NCBI RefSeq record:
NM_025831.3
NBCI Gene record:
Pxdc1 (66895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431025 TTCAGCAGGCCTGGGTATTTA pLKO_005 1059 3UTR 100% 15.000 21.000 N Pxdc1 n/a
2 TRCN0000432316 ATGAGCCGGAAGGAGCGTTTA pLKO_005 1421 3UTR 100% 10.800 15.120 N Pxdc1 n/a
3 TRCN0000198807 CCTTCTTTGAAAGATCGCCTT pLKO.1 620 CDS 100% 2.160 3.024 N Pxdc1 n/a
4 TRCN0000430834 ATCATGAGGTCCAATGGATTT pLKO_005 715 CDS 100% 10.800 8.640 N Pxdc1 n/a
5 TRCN0000414542 GTCACCAACTTGTCCTATTAC pLKO_005 886 CDS 100% 13.200 9.240 N Pxdc1 n/a
6 TRCN0000432114 GTCATCAGCATGCCGTGTAAG pLKO_005 574 CDS 100% 10.800 7.560 N Pxdc1 n/a
7 TRCN0000434140 TCAAGGGTGCACATGACATAG pLKO_005 515 CDS 100% 10.800 7.560 N Pxdc1 n/a
8 TRCN0000424510 ATTCCAGGTCTGAGGTTGTTC pLKO_005 596 CDS 100% 4.950 3.465 N Pxdc1 n/a
9 TRCN0000427515 TTGAGAATGGTGGTGAGTTCA pLKO_005 827 CDS 100% 4.950 3.465 N Pxdc1 n/a
10 TRCN0000429499 AGGCTCAATGAGGTCGAGAAG pLKO_005 541 CDS 100% 4.050 2.835 N Pxdc1 n/a
11 TRCN0000177921 CTTCTTTGAAAGATCGCCTTT pLKO.1 621 CDS 100% 4.050 2.835 N Pxdc1 n/a
12 TRCN0000182363 GTTCCGTTTGAGACGGACATT pLKO.1 913 CDS 100% 0.495 0.347 N Pxdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025831.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.