Transcript: Mouse NM_026040.3

Mus musculus serum response factor binding protein 1 (Srfbp1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Srfbp1 (67222)
Length:
1463
CDS:
28..1353

Additional Resources:

NCBI RefSeq record:
NM_026040.3
NBCI Gene record:
Srfbp1 (67222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245393 ACCTGATGTTGTAACTAAATC pLKO_005 264 CDS 100% 13.200 18.480 N Srfbp1 n/a
2 TRCN0000244522 CCTCAATAACGAGGTTGTAAA pLKO_005 81 CDS 100% 13.200 18.480 N Srfbp1 n/a
3 TRCN0000244523 CACTCGTTGGCTGGACCTAAA pLKO_005 1099 CDS 100% 10.800 7.560 N Srfbp1 n/a
4 TRCN0000244524 TTAGTGATGATATCAACTTTG pLKO_005 290 CDS 100% 10.800 7.560 N Srfbp1 n/a
5 TRCN0000175787 GCCATGAAGGAATTGAAACCT pLKO.1 247 CDS 100% 3.000 2.100 N Srfbp1 n/a
6 TRCN0000245392 TGGGATGTAAGAAACGATAAA pLKO_005 1033 CDS 100% 13.200 7.920 N Srfbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026040.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.