Transcript: Mouse NM_026100.3

Mus musculus Tctex1 domain containing 1 (Tctex1d1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tctex1d1 (67344)
Length:
2029
CDS:
258..779

Additional Resources:

NCBI RefSeq record:
NM_026100.3
NBCI Gene record:
Tctex1d1 (67344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427756 ATTAGTGATTCCGAGATATAA pLKO_005 599 CDS 100% 15.000 21.000 N Tctex1d1 n/a
2 TRCN0000427867 GTCAGTGCCATTCACATAAAT pLKO_005 973 3UTR 100% 15.000 12.000 N Tctex1d1 n/a
3 TRCN0000431375 GATGACCAGAGCATAGTTATT pLKO_005 651 CDS 100% 13.200 10.560 N Tctex1d1 n/a
4 TRCN0000183152 GATGTACTAACTACCTACCTA pLKO.1 498 CDS 100% 3.000 2.400 N Tctex1d1 n/a
5 TRCN0000429109 GCAACATACTCTGGATATATA pLKO_005 1103 3UTR 100% 15.000 10.500 N Tctex1d1 n/a
6 TRCN0000195946 CGTGGCCACTGTCAATCATAT pLKO.1 470 CDS 100% 13.200 9.240 N Tctex1d1 n/a
7 TRCN0000421645 AGATGCCTCTGGAATCCTAAA pLKO_005 678 CDS 100% 10.800 7.560 N Tctex1d1 n/a
8 TRCN0000183082 CAAATGTCTATGCAGTTTACT pLKO.1 751 CDS 100% 5.625 3.938 N Tctex1d1 n/a
9 TRCN0000179501 GAAAGTGGTCCTTGTGTGTTA pLKO.1 782 3UTR 100% 4.950 3.465 N Tctex1d1 n/a
10 TRCN0000419142 AGGCCTTAGTACTGCATATAA pLKO_005 1186 3UTR 100% 15.000 9.000 N Tctex1d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026100.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.