Transcript: Mouse NM_026150.3

Mus musculus RIKEN cDNA 4921536K21 gene (4921536K21Rik), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
4921536K21Rik (67430)
Length:
2618
CDS:
40..546

Additional Resources:

NCBI RefSeq record:
NM_026150.3
NBCI Gene record:
4921536K21Rik (67430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198074 CAGGACTACTTGGATAAGGAA pLKO.1 517 CDS 100% 3.000 4.200 N 4921536K21Rik n/a
2 TRCN0000177995 GCCATTTATCTCGGGTGATTA pLKO.1 335 CDS 100% 13.200 9.240 N 4921536K21Rik n/a
3 TRCN0000344470 GCCATTTATCTCGGGTGATTA pLKO_005 335 CDS 100% 13.200 9.240 N C5orf52 n/a
4 TRCN0000178642 CCCGAATATCAGCTCTTCTTT pLKO.1 910 3UTR 100% 5.625 3.938 N 4921536K21Rik n/a
5 TRCN0000216601 GTTGTTATTCAGCTTAATGAA pLKO.1 276 CDS 100% 5.625 3.938 N 4921536K21Rik n/a
6 TRCN0000177766 CAAGAGGAAGATGAGCTACTT pLKO.1 417 CDS 100% 4.950 3.465 N 4921536K21Rik n/a
7 TRCN0000177535 CAATGATGCAAACGTGAAGAA pLKO.1 300 CDS 100% 4.950 3.465 N 4921536K21Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.