Transcript: Mouse NM_026177.3

Mus musculus GPALPP motifs containing 1 (Gpalpp1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Gpalpp1 (67467)
Length:
5448
CDS:
112..1152

Additional Resources:

NCBI RefSeq record:
NM_026177.3
NBCI Gene record:
Gpalpp1 (67467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216626 GATAAAGATCTCAAGGTTAAT pLKO.1 1039 CDS 100% 13.200 18.480 N Gpalpp1 n/a
2 TRCN0000179944 CGAGCAAGTATCCTCATACAA pLKO.1 912 CDS 100% 5.625 7.875 N Gpalpp1 n/a
3 TRCN0000134800 CTCAAGGTTAATCGGTTTGAT pLKO.1 1048 CDS 100% 5.625 7.875 N GPALPP1 n/a
4 TRCN0000134564 GATCTCAAGGTTAATCGGTTT pLKO.1 1045 CDS 100% 4.050 5.670 N GPALPP1 n/a
5 TRCN0000184512 GCCTATAATAGGTCCCGCATT pLKO.1 432 CDS 100% 4.050 5.670 N Gpalpp1 n/a
6 TRCN0000264350 ATACCATTTGACCGTGATAAA pLKO_005 1024 CDS 100% 13.200 10.560 N Gpalpp1 n/a
7 TRCN0000264351 TCTCCTCCCAGGCCTATAATA pLKO_005 421 CDS 100% 15.000 10.500 N Gpalpp1 n/a
8 TRCN0000264353 AGCGGTGAAGATGAGGATATT pLKO_005 547 CDS 100% 13.200 9.240 N Gpalpp1 n/a
9 TRCN0000216666 CCAAACTGAACCTAGTCTATA pLKO.1 2591 3UTR 100% 13.200 9.240 N Gpalpp1 n/a
10 TRCN0000264352 TACGCCTTAAATATCCATAAT pLKO_005 1705 3UTR 100% 13.200 9.240 N Gpalpp1 n/a
11 TRCN0000179198 GAAGGCAATCAAGAGTCTGAA pLKO.1 286 CDS 100% 4.950 3.465 N Gpalpp1 n/a
12 TRCN0000134582 GAATACCATTTGACCGTGATA pLKO.1 1022 CDS 100% 4.950 3.465 N GPALPP1 n/a
13 TRCN0000264349 CCTCATGGACATTCATCATAA pLKO_005 954 CDS 100% 13.200 7.920 N Gpalpp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.