Transcript: Mouse NM_026181.1

Mus musculus G patch domain containing 1 (Gpatch1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gpatch1 (67471)
Length:
3057
CDS:
28..2820

Additional Resources:

NCBI RefSeq record:
NM_026181.1
NBCI Gene record:
Gpatch1 (67471)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123521 GCTCACGTACTTCAGGTGTTA pLKO.1 1192 CDS 100% 4.950 6.930 N Gpatch1 n/a
2 TRCN0000123522 CCAGAGTGAAGAGGGATAAAT pLKO.1 1940 CDS 100% 15.000 10.500 N Gpatch1 n/a
3 TRCN0000123520 CCCAGAGTGAAGAGGGATAAA pLKO.1 1939 CDS 100% 13.200 9.240 N Gpatch1 n/a
4 TRCN0000123523 CCAGGAGAACACCTGAATCTT pLKO.1 778 CDS 100% 5.625 3.938 N Gpatch1 n/a
5 TRCN0000123519 CCTCCATGATGCACATCCATT pLKO.1 2857 3UTR 100% 4.950 3.465 N Gpatch1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.