Transcript: Mouse NM_026218.2

Mus musculus FGFR1 oncogene partner 2 (Fgfr1op2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fgfr1op2 (67529)
Length:
2828
CDS:
301..1062

Additional Resources:

NCBI RefSeq record:
NM_026218.2
NBCI Gene record:
Fgfr1op2 (67529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249683 GAAAGATGACCCAGGTATAAT pLKO_005 648 CDS 100% 15.000 12.000 N Fgfr1op2 n/a
2 TRCN0000249682 GTCTATTGTGAAACGTTATTT pLKO_005 2601 3UTR 100% 15.000 12.000 N Fgfr1op2 n/a
3 TRCN0000249681 ACCGAGATGGCAGCAGTAATG pLKO_005 838 CDS 100% 10.800 7.560 N Fgfr1op2 n/a
4 TRCN0000249685 CTATCTGCCTTAGTGACTAAC pLKO_005 1015 CDS 100% 10.800 7.560 N Fgfr1op2 n/a
5 TRCN0000249684 AGGAACAGGAGCGGATATTTC pLKO_005 896 CDS 100% 13.200 7.920 N Fgfr1op2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026218.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02918 pDONR223 100% 60.5% 66.4% None (many diffs) n/a
2 ccsbBroad304_02918 pLX_304 0% 60.5% 66.4% V5 (many diffs) n/a
3 TRCN0000480334 CCAATTAGCTTCCAACTTATCCCT pLX_317 73.6% 60.5% 66.4% V5 (many diffs) n/a
Download CSV