Transcript: Mouse NM_026313.1

Mus musculus LUC7-like 3 (S. cerevisiae) (Luc7l3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Luc7l3 (67684)
Length:
3327
CDS:
124..1599

Additional Resources:

NCBI RefSeq record:
NM_026313.1
NBCI Gene record:
Luc7l3 (67684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123509 GCCATAGTATAGAGGAATAAT pLKO.1 2370 3UTR 100% 15.000 21.000 N Luc7l3 n/a
2 TRCN0000305510 GTGTAGGGTTTATGAATTATT pLKO_005 1916 3UTR 100% 15.000 21.000 N Luc7l3 n/a
3 TRCN0000123513 TGAGAAGAGTTCTCGCTTTAT pLKO.1 333 CDS 100% 13.200 18.480 N Luc7l3 n/a
4 TRCN0000316928 TGAGAAGAGTTCTCGCTTTAT pLKO_005 333 CDS 100% 13.200 18.480 N Luc7l3 n/a
5 TRCN0000123511 CGCAGAATTAGACGAGGTCAT pLKO.1 415 CDS 100% 4.050 5.670 N Luc7l3 n/a
6 TRCN0000123512 GCCGAGATCGAAAGTCATATA pLKO.1 1187 CDS 100% 13.200 10.560 N Luc7l3 n/a
7 TRCN0000317005 GCCGAGATCGAAAGTCATATA pLKO_005 1187 CDS 100% 13.200 10.560 N Luc7l3 n/a
8 TRCN0000305454 GGGACCAGTGAAGACATTAAA pLKO_005 1375 CDS 100% 15.000 10.500 N Luc7l3 n/a
9 TRCN0000075114 CCTGCGGAATTGTTCACAAAT pLKO.1 253 CDS 100% 13.200 9.240 N LUC7L3 n/a
10 TRCN0000375023 CCTGCGGAATTGTTCACAAAT pLKO_005 253 CDS 100% 13.200 9.240 N Luc7l3 n/a
11 TRCN0000374966 CTCTACCCACATCCGTGTTTG pLKO_005 2052 3UTR 100% 10.800 7.560 N Luc7l3 n/a
12 TRCN0000123510 GCCGAGTAAGAAGACATACAA pLKO.1 1439 CDS 100% 5.625 3.938 N Luc7l3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026313.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12015 pDONR223 100% 13.7% 11.9% None (many diffs) n/a
2 ccsbBroad304_12015 pLX_304 0% 13.7% 11.9% V5 (many diffs) n/a
Download CSV