Transcript: Mouse NM_026321.4

Mus musculus family with sequence similarity 174, member A (Fam174a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fam174a (67698)
Length:
2107
CDS:
190..762

Additional Resources:

NCBI RefSeq record:
NM_026321.4
NBCI Gene record:
Fam174a (67698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127059 CCATTGTTGTTGCTTTCGTTT pLKO.1 1095 3UTR 100% 4.950 3.960 N Fam174a n/a
2 TRCN0000127062 GATGATGACAACACATTGTTT pLKO.1 718 CDS 100% 5.625 3.938 N Fam174a n/a
3 TRCN0000363819 GATGATGACAACACATTGTTT pLKO_005 718 CDS 100% 5.625 3.938 N Fam174a n/a
4 TRCN0000127063 CGAACATAGAGAACATGGAAT pLKO.1 671 CDS 100% 4.950 3.465 N Fam174a n/a
5 TRCN0000334192 CGAACATAGAGAACATGGAAT pLKO_005 671 CDS 100% 4.950 3.465 N Fam174a n/a
6 TRCN0000127060 GAACATGGAATTGACACCTTT pLKO.1 681 CDS 100% 4.950 3.465 N Fam174a n/a
7 TRCN0000334193 GAACATGGAATTGACACCTTT pLKO_005 681 CDS 100% 4.950 3.465 N Fam174a n/a
8 TRCN0000127061 GATGAGAAGAAGAAACCGCAA pLKO.1 624 CDS 100% 2.160 1.296 N Fam174a n/a
9 TRCN0000334259 GATGAGAAGAAGAAACCGCAA pLKO_005 624 CDS 100% 2.160 1.296 N Fam174a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.