Transcript: Mouse NM_026350.3

Mus musculus coiled-coil domain containing 130 (Ccdc130), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ccdc130 (67736)
Length:
2169
CDS:
298..1455

Additional Resources:

NCBI RefSeq record:
NM_026350.3
NBCI Gene record:
Ccdc130 (67736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180850 GCAACTATTACACGACTCCAA pLKO.1 527 CDS 100% 2.640 3.696 N Ccdc130 n/a
2 TRCN0000184676 CCTGGACTCTTATGAGGACAA pLKO.1 1002 CDS 100% 4.050 2.835 N Ccdc130 n/a
3 TRCN0000155671 CTGTGTCAACTACATCGAGAT pLKO.1 576 CDS 100% 4.050 2.835 N CCDC130 n/a
4 TRCN0000184450 GCCATACAACATCTGGTGTGA pLKO.1 447 CDS 100% 2.640 1.848 N Ccdc130 n/a
5 TRCN0000180734 GACAACTCCTTGTCAGAAGAA pLKO.1 1231 CDS 100% 0.495 0.347 N Ccdc130 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.