Transcript: Mouse NM_026432.3

Mus musculus store-operated calcium entry-associated regulatory factor (Saraf), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Saraf (67887)
Length:
1914
CDS:
82..1173

Additional Resources:

NCBI RefSeq record:
NM_026432.3
NBCI Gene record:
Saraf (67887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340641 GTTCTCGCCTTTGCGGTTTAC pLKO_005 703 CDS 100% 10.800 15.120 N Saraf n/a
2 TRCN0000173913 CGGCTTGGAGTACAACTTAGA pLKO.1 561 CDS 100% 4.950 6.930 N Saraf n/a
3 TRCN0000175754 GAATGTAAGACCGACTTGGAT pLKO.1 457 CDS 100% 3.000 4.200 N Saraf n/a
4 TRCN0000340638 GAATGTAAGACCGACTTGGAT pLKO_005 457 CDS 100% 3.000 4.200 N Saraf n/a
5 TRCN0000174955 GCTTGGAGTACAACTTAGATT pLKO.1 563 CDS 100% 5.625 4.500 N Saraf n/a
6 TRCN0000340714 GCTTGGAGTACAACTTAGATT pLKO_005 563 CDS 100% 5.625 4.500 N Saraf n/a
7 TRCN0000174726 GCAAAGTTTCTGATTTGTCAT pLKO.1 1202 3UTR 100% 4.950 3.465 N Saraf n/a
8 TRCN0000340640 GCAAAGTTTCTGATTTGTCAT pLKO_005 1202 3UTR 100% 4.950 3.465 N Saraf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.