Transcript: Mouse NM_026440.4

Mus musculus RNA (guanine-7-) methyltransferase (Rnmt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Rnmt (67897)
Length:
5018
CDS:
114..1511

Additional Resources:

NCBI RefSeq record:
NM_026440.4
NBCI Gene record:
Rnmt (67897)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039146 CCTGCACATGAGAACTCTAAA pLKO.1 1344 CDS 100% 13.200 10.560 N Rnmt n/a
2 TRCN0000308862 CCTGCACATGAGAACTCTAAA pLKO_005 1344 CDS 100% 13.200 10.560 N Rnmt n/a
3 TRCN0000039145 GCGGATACGATGCTTAGAAAT pLKO.1 969 CDS 100% 13.200 9.240 N Rnmt n/a
4 TRCN0000308861 GCGGATACGATGCTTAGAAAT pLKO_005 969 CDS 100% 13.200 9.240 N Rnmt n/a
5 TRCN0000039147 GCTAACTGAAATGGCAAAGAA pLKO.1 1211 CDS 100% 5.625 3.938 N Rnmt n/a
6 TRCN0000308863 GCTAACTGAAATGGCAAAGAA pLKO_005 1211 CDS 100% 5.625 3.938 N Rnmt n/a
7 TRCN0000039144 CCCAGCATTCTTGGAACCTAA pLKO.1 3589 3UTR 100% 4.950 3.465 N Rnmt n/a
8 TRCN0000039148 CCAGCAAGTAGATCAGCCAAA pLKO.1 224 CDS 100% 4.050 2.430 N Rnmt n/a
9 TRCN0000308781 CCAGCAAGTAGATCAGCCAAA pLKO_005 224 CDS 100% 4.050 2.430 N Rnmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026440.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.