Transcript: Mouse NM_026468.2

Mus musculus ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9) (Atp5g2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Atp5g2 (67942)
Length:
647
CDS:
61..501

Additional Resources:

NCBI RefSeq record:
NM_026468.2
NBCI Gene record:
Atp5g2 (67942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075753 GTTTCCAAACCAGCGCCATTT pLKO.1 248 CDS 100% 10.800 15.120 N Atp5g2 n/a
2 TRCN0000075756 CAACTCTTCTCCTACGCGATT pLKO.1 406 CDS 100% 4.050 3.240 N Atp5g2 n/a
3 TRCN0000075755 GCCAACAGATGAGAGCCTCAG pLKO.1 180 CDS 100% 0.750 0.600 N Atp5g2 n/a
4 TRCN0000075757 GCGGCCTCTGACTTCACTTAT pLKO.1 216 CDS 100% 13.200 9.240 N Atp5g2 n/a
5 TRCN0000447085 TTTGCCTAATGGTGGCCTTTC pLKO_005 461 CDS 100% 6.000 4.200 N Atp5g2 n/a
6 TRCN0000435262 GCTGTCTGCAGTGGAGTTGAA pLKO_005 147 CDS 100% 4.950 3.465 N Atp5g2 n/a
7 TRCN0000043492 AGGAACCCTTCTCTGAAGCAA pLKO.1 385 CDS 100% 3.000 2.100 N ATP5MC2 n/a
8 TRCN0000075754 GCTCCCTGATCAGGAGCACCT pLKO.1 92 CDS 100% 0.000 0.000 N Atp5g2 n/a
9 TRCN0000440964 ACACAGCTGCCAAGTTCATTG pLKO_005 281 CDS 100% 10.800 6.480 N Atp5g2 n/a
10 TRCN0000418280 CATCCTCTTCGCCATGTGAAG pLKO_005 483 CDS 100% 4.050 2.025 Y Atp5g2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026468.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.