Transcript: Mouse NM_026512.1

Mus musculus biphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen) (Bphl), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Bphl (68021)
Length:
1224
CDS:
23..898

Additional Resources:

NCBI RefSeq record:
NM_026512.1
NBCI Gene record:
Bphl (68021)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221429 GCTGCAAAGTACCCATCTTAT pLKO.1 467 CDS 100% 13.200 18.480 N Bphl n/a
2 TRCN0000350103 GGGTAGCGGAAAGACCGATTT pLKO_005 232 CDS 100% 10.800 15.120 N Bphl n/a
3 TRCN0000221431 GCACAACTTACACTTACGCTT pLKO.1 835 CDS 100% 2.640 3.696 N Bphl n/a
4 TRCN0000317991 GCACAACTTACACTTACGCTT pLKO_005 835 CDS 100% 2.640 3.696 N Bphl n/a
5 TRCN0000221428 CCCATCTTATATCCGCAAGAT pLKO.1 478 CDS 100% 0.495 0.693 N Bphl n/a
6 TRCN0000314191 TCAGCTTCAGAGCCTAAATAA pLKO_005 259 CDS 100% 15.000 10.500 N Bphl n/a
7 TRCN0000221430 GTATCCGAGATGTTTCTAAAT pLKO.1 555 CDS 100% 13.200 9.240 N Bphl n/a
8 TRCN0000317998 GTATCCGAGATGTTTCTAAAT pLKO_005 555 CDS 100% 13.200 9.240 N Bphl n/a
9 TRCN0000314190 GATCATGTCATTGCCTGTTAC pLKO_005 946 3UTR 100% 10.800 7.560 N Bphl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.